Skip to end of metadata
Go to start of metadata

Zebrafish Genetic Map: Primers Page

This table contains the primer sequences for the microsatellite markers on the zebrafish genetic linkage map, as published in Nature Genetics: A Microsatellite Genetic Linkage Map for Zebrafish (Danio rerio), Ela W. Knapik, et al.
The primers are available from Research Genetics.

Primer

LG

Forward sequence

Bases

Reverse sequence

Bases

PCR Product Size

BMP4

17

CTGTGAGGAGCTTCCATCACGAA

23

GGAATCGGCAGAGGCTGTCTCC

22

160

msxD

21

AGCTCCGTCTTCACTGACTGACA

23

TGTGGTGGACATTAACTCATCCA

23

240

Z4

14

TCAGAGGAGCGCATGAAAGT

20

CTGAAAACACCCATCACGTG

20

119

Z7

19

TCATGAGCAGCGTTTTTCC

19

AAAGCACCATCCCACAAAAC

20

145

Z13

5

CACGTGCTGATGCAGGAC

18

GATGACAGCCAATCAGAGCA

20

144

Z16

21

ATACTCAAACACATCCCAGCC

21

GAGGTGCACGTCAGCGAC

18

150

Z18

21

CTCTTTTGCCTCCTCTCGG

19

CAGCCTTAACACTGTGTCTGTG

22

147

Z23

2

TGTAGATTAATGCTTTTCTGTGCA

24

GCATATGAAGCAGGTCTGCA

20

133

Z24

15

CACCTTCACGGTGAGTAGCA

20

GTGGAATGGTGTGACTAATGTCA

23

149

Z28

13

TCTGGTGGACTCGCTGAAG

19

AAGTAAGCGCCACCAGAGTG

20

141

Z37

15

GGTGTTCGCGACCAAGTC

18

TTTGCGTGGAATTTGAACTG

20

83

Z46

2

GCTGTGTGTGCCTCATCTGT

20

GCAGACGCTGTACTCCATCA

20

224

Z49

25

GATTATCCTCATAAGTACGGGCC

23

AGCACATCTTCATCCTGCG

19

216

Z106

9

GAGACCGACCGTCTGCTAAC

20

TCCAGAGAACACCCTGCTG

19

187

Z130

23

ACACGCTGGAGAGCCAAC

18

CCAGAACCCACCTGGGAC

18

104

Z140

8

ATTTGGCAGATTCCTTCATCA

21

GGAACACCTGTGCCCGAG

18

213

Z160

19

CGCTACCTGAAGGACACCAT

20

CTGCTATTGCTATACTTGTGGGG

23

240

Z164

1

TTGCTGTGTGTGTTTCTCAGTG

22

TGTTCCATCGCTGAGAAGTG

20

221

Z170

8

CTGAAAGTCTTCACATCTGTGACA

24

GAATAAAGGTGGGGGGTGTT

20

121

Z176

23

CTCCAGAACAGGTTAGACACACC

23

CTGAACACCTCGAACCTTTACC

22

219

Z177

7

GGAAACTCTCACGCTCGTTC

20

ACGGATGTTCCTGTAAACGC

20

143

Z178

22

ACCACAAGCGTGTGAGTCTG

20

TTGACTGTGGCCTGCTGTAG

20

108

Z191

7

AATATAGCGAAGGGACGATCC

21

GAGGACTTCAGCAGAAACCG

20

123

Z230

22

GGTTCTCCCACCAGCACTAA

20

CGACTCAGACTTACTGGTGTGC

22

141

Z233

25

CAGTTTTCGGGACCTCTGAG

20

TGGATGAAGTTTACGGAGCC

20

148

Z241

24

CAATTAAAGGTGCAGTGGAGC

21

TTGGCCTCTGCTGTTTCTCT

20

231

Z247

12

GATTTACCTGTTTCACAGCATCC

23

CATCCTGAGATGTCATCTGATAGA

24

242

Z249

24

TCTTCCCCTACAGGCACAGT

20

ATGATACGCAGTCAACGTATCG

22

147

Z265

6

CCTTCCCTCAAAGAGCGAG

19

TGGAGTCGCTCATTAGCAAA

20

113

Z266

17

TCCGGCTGACATGAGGAAT

19

ACGCTCTGCTTCATGGTCTT

20

212

Z342

23

CATTGAGTTTAGACCCCCACA

21

TCACTTCTGCTTTATAAGGCACC

23

163

Z355

10

CAGCCTGAGCACACAGAGAC

20

GCACAGGCCTAATAAGACGC

30

204

Z374

20

TTTTAATCCAGCAGCAGATCTG

22

CCCAGGTTCACAAACCCTC

19

166

Z379

5

AGCCTTTCACTGGCCCTATT

20

CAAGGTGGAGTAAAAATCCTGC

22

222

Z381

17

AAACGTTGTGATGTGATATTCCC

23

TCTCCAGAAGCCTCGTGTG

19

205

Z382A B

7 7

GTGTCCGTTTTTTCGGTGTT

20

TAGCACGCTAACGGCTAACA

20

104

Z419

3

ATTATCCAGCACATGACGAGG

21

TCTCGCTCCTCACCATCAC

19

120

Z450

1

AAGTACAGCATTGTCCACAGTCA

23

CAGGGAAACTGCTGATGTTG

20

154

Z464

25

ACCTCCACACGGAAAGGAG

19

GGTGATGAAAAATTAGCCTTCG

22

156

Z470

15

GAGAGCCGAGGTGTGTATGC

20

CACTGCCTATTACACCACTGATG

23

139

Z531

10

GCAGGTTGCTCTGGTTTCTC

20

TTTCCGATGACAGATCGTGA

20

118

Z536

20

ATCCAGAGTGTGTCCCAGTTG

21

AGGTGTGTCCCACTGACTCC

20

118

Z540

21

GTGGCCGTCAGTTCAGCT

18

CCTCCTGTCAGGTGAAGCTC

20

127

Z553

19

GGCGTAATCCTCATTCCTGA

20

CAAACTGTGTTGTGTGTTTTTCTG

24

209

Z559

9

ACCCGGCTGTAGTGAAACC

19

CCTCTCTGCCCTCCTCTTG

19

114

Z562

9

TGTACTTCTCTCTCAATACACCGG

24

AGGCCTCTGATTAACTGAATTACA

24

207

Z618

14

CCTTTCACACTATACAGCGTATCA

24

TCTTCTGGGGTTTACTGCTCA

21

165

Z643

23

AGGCTGGGCTATAATGCTGA

20

TAACGAGTCTGTGTTTCGCG

20

241

Z644

2

CACGGACAATCCAGTGTACG

20

GCAACAGTATAAGACTGTCTTGGG

24

144

Z647

5

GTGAGAGGTACGGCAGGAGA

20

AAACAACCCTGCATCCACTC

20

249

Z652

17

AGAGAGTGAGCTCTGGAACCC

21

CACTCTTGAAGATGGCAGAGG

21

132

Z669

22

GTGTGTGATGTTGTGTTTGTCG

22

GGGGTCACTTCTGTTTACAAGC

22

137

Z684

22

GCTACAGCTCGCCTGTGTG

19

ATCCGATACAGCCCGAGTC

19

89

Z685

11

GGTGCTCGCAGGTGTTAATT

20

CCAGGGCGTGATGTACTTTT

20

204

Z697

14

AAAGTGTTACCGGGCAACAG

20

GGGTTAGCATGTGGGCTG

18

114

Z699

16

CTTGTGAACGTAGCCGTTGA

20

TAAAACCACACACGAGCAGC

20

209

Z720

23

ACTCTCAACATGAAGTGCTTTCC

23

ACAGGGAATGAGCTGAGAACA

21

145

Z722

21

AACTGAATGACTATGGGCGC

20

TCTTCTTGGTAACCAGACAAAGC

23

101

Z728

1

GTGGTCATGTGACACAGGATG

21

GCTCTTACAGTCCTGAGAACAGC

23

204

Z732

15

GTGCCTTCCGTTACCTTCAC

20

TTTTAAGGAAAAAAAGTGAATGCA

24

133

Z737

18

AACACTTGATATTGCATGACGG

22

ATGTTGGTTAGCATGCACCA

20

126

Z740

6

AAACTTTGCTGCTCTTCCTCC

21

CTCTGTCAGGTCCTGTGATCC

21

203

Z744

10

TATACTGCTTATTGGTGAAATCCG

24

CTGTACAGCCCAGACAAGAGC

21

149

Z787

25

GCTGCGTGATATTCATGGG

19

CTGTATCCTGCTATACAGCCCC

22

111

Z789

8

CTCCTGCTGGCCCAGTAAT

19

ACTGAACATTCAGGCTTAAATGC

23

203

Z793

6

TGGTGAAATTTTGGACAGCA

20

CAAGGACCAAATGGAAGGAA

20

205

Z811

16

CCATGTGGGTGGAAAAGACT

20

CTGTCTTTCAGTTTTGCTTATGTG

24

175

Z818

13

CATGGCTTTACTGCTCTGAGC

21

CTTGTGCTCAAACTGAACACTG

22

147

Z846

15

CCTCTCAGTCTCCATCACCTG

21

GTGTGTGCTATAATGCCATTGG

22

94

Z851

2

ACAGTCTTTACTCCGCAATAATCC

24

ACTGAAGAGGAGGACCAGAGC

22

142

Z852

17

CCAGACTAACCAGACCTGAACC

22

GAACATACCTGAACAGAAAACACG

24

215

Z854

9

TCTTCTGAATCCTCACTCAGAGC

23

CCATAATGCATTTGGGGAAG

20

139

Z858

15

CTTCCACATGGTCATTATGGG

21

AACCAGTGGAGCGACCAG

18

209

Z868

11

GATCTCCCTAATTATAGCACTCGC

24

TCATCGCATCTGCAGTCAG

19

128

Z870

8

TTCCGGCTCTCAGTGTCTTT

20

CCTGACCAGCATAGAGTCATG

21

193

Z872

3

CTTAAAGCCCAGTGAGGCAC

20

ATGCCTGGTAATGAGCAGCT

20

220

Z879

14

TGAGGAGGTTTGTCACCACA

20

TGAAAAAAACACCAAGCGC

19

203

Z880

6

TGATCTGAGACGTCTGCCG

19

GCGCTCTGACAGTGCTTACA

20

150

Z896

5

ACAACCACAGCATGACCTCA

20

ACAAGTGCTGCAGAAGATGTATG

23

139

Z911

24

GCTGCTTGTGGTGTGAAAAA

20

TAATTTCATTCCACCTGCTGG

21

126

Z916

9

GGATCTGTTCAGCCACTGAA

20

TCACCTGATCACCATGCAGT

20

150

Z928

18

CCAGAGTACTCGATCTGTCTTGA

23

ACACCTTCGGCAGTTTTCAC

20

134

Z937

12

AGAGCTAGCGCTGAGCTAACA

21

TCTCTCTGTTCATCAGCAGCA

21

137

Z938

22

CAGACGGACAAGTGGAGGAT

20

CAAATGCTTCTCACTTCCTCG

21

206

Z940

15

CTGCTAACCAAATGCAGAAGC

21

TAACCTGATGGAAAATCACACG

22

121

Z953

21

AGAAAAGAGTGAGGACTGTGTGC

23

TGCGAGTTGACAGCCTGTAC

20

98

Z963

3

ACTGGCACTTCACGCTCC

18

TCTCACACTGAGTGCTAAACGG

22

201

Z974

14

AGCTCCAGCCCTACAACTACC

21

TGAAGTTCAGACTAATGATCTCGC

24

206

Z975

25

ACCTGTGTCATACCCATGTCA

21

CTGGTGTCCCCCACAGTC

18

150

Z984

4

TTTCTCAGAGCACAACCTTTAAC

23

GAGAGCAAACTCCAGCTGCT

20

200

Z987

8

TCTGGTTTCACATTAACATGTGC

23

ATCTGCTATCGGCTCTGTTAGC

22

235

Z992

16

TTGACGTAGTTTGTGCGTTTG

21

CAATCAGAGCAGGAGGCG

18

150

Z1050

6

ACTCTGAGTCTGCAGTCCCG

20

AACTGCTGCAGTTAATTATTGC

22

145

Z1052

8

CCCATTGGAACTGAGACACCTT

22

ACAGGGGGGGCTAATAATTCTG

22

138

Z1059

7

AACAGGTGACAGAGCACACG

20

GGGAGAGGGCAGGACAATAT

20

150

Z1061

24

CATCGCTGGTTACTGCTGG

19

TCTCTATTATAAGCCTCCTCACCG

24

102

Z1068

8

GGTGAGAAACACAAGAGCAGC

21

CAGACCCAGATTCTTCAGCC

20

132

Z1136

18

TCATGTGAAGCCTGCAGTTC

20

AGCTTCAGCTGTTTAAAGGTGC

22

105

Z1138

6

GAACGACGGCACTCTATCCG

20

TTGCAGCCTTAGTGTAAACGAA

22

151

Z1140

3

CGCTTCAGCCTCAATCTCTC

20

TGTAGCTTTCTGGGCCTGAT

20

197

Z1141

12

TCTGTCCTGTGCGCAGAG

18

AGTTCCAGTGCAGACGGTG

19

138

Z1144

18

CTCCTCTCCGGGATACACAC

20

ACCACGAGTCTGAGTGCTGA

20

249

Z1145

10

GGGAACGACCCTTTTCAATT

20

TCCAAGTTGGCATAGATGTATCT

23

199

Z1146

12

ATGCCACCCCTCTCCTTC

18

TGCCAACATGCTAACAATATCC

22

144

Z1148

22

GGCTACACCTCAAACGCTTC

20

CAACACCTGATCAAACGCC

19

200

Z1154

1

TCATGATTGTTTGGAATGTAATAGTG

26

TTGAGCGGTAGTCTTCTACGC

21

130

Z1159

2

CGCTAATGACTAGCGTGACG

20

ATAACCACAGTGATAAACGCA

21

140

Z1162

21

TTTATTAATATTCTGTGCTGGGC

23

GCCGGAAAGACACCTTCATA

20

131

Z1167

5

TCCCTTTGTAACATCGGCTC

20

AAGCCCCGACTACTGTCTGA

20

189

Z1173

1

CAACAGTGATCACACCGACC

20

CTGCCCTTCTCTGAATCAGG

20

123

Z1176

12

GAGGATTTAATCATCATTTGCTCC

24

AAACACCACGATCAGCAGC

19

125

Z1179

12

CAGGGAACCGTCACATTCAGC

21

TCTGCAGACTCCCACTGACCC

21

198

Z1182

7

GAGCAGACACTTTACATTTTGTGG

24

GACACTTACAAAGAGTCTTTCATTTCC

27

147

Z1183

3

CCGCGGAAGATTAATCAGAC

20

AGATTCACTCCGTGCTCCAT

20

139

Z1185

3

CAGCAGGAACGAGGACGTCA

20

GGGTGGGGTTAGGGCAATAG

20

248

Z1191

3

TCAGAACTCCAGCCACCAG

19

TGGATATACTTTATCCCTAACTGAACG

27

146

Z1195

15

AACCCACACCGTCACATCGT

20

ATACGCCACTGACGAGAAGTGG

22

173

Z1197A,B

14,25

AGTGTGTAGTCCTGCTGCGGG

21

ATCCTAGCTGGTAAGGCAGGGC

22

225

Z1201

18

GGAGCTGTGGAGCACAGAAA

20

CGTGTACTACCCCGGCAC

18

157

Z1202

5

GTCAGGACCATACCCAGAGC

20

CAGCGACTGACGGTTCTGT

19

140

Z1206

7

CGTCTGACAGCCTGCATG

18

CTCGGCGCAGTAGGGAAC

18

149

Z1209

3

CCTGAGCACATGTATGCAGTCG

22

CACAATCGCAGAGCAGCGCC

20

150

Z1213

25

CAGAAATGATGAAGCGTAAATAATG

25

ACCACCTCGCCCAGAGTAC

19

127

Z1215

16

TCCTGTGATGTACAGCCTGG

20

GAACCAAGCCCTCGCTTC

18

150

Z1217

7

CGCTTGTCACCAAGGTACAA

20

AACGGAAGTGAATTGCCAAC

20

110

Z1224

7

TCACAGTGGTGTAATGCTGC

20

ACATAGTGGACAAACCTGAACA

22

200

Z1225

12

CGAGCCGATAATGAATATACAGC

23

CCACCGTGACACCCTTAATT

20

142

Z1226

14

AAGTTTGCACATTACCATCGG

21

GCCGAGGCAAATATTTTCAA

20

150

Z1227

9

ACAGTGTTGACCTGCCGAC

19

GAATGAGCAGAAATCTCCGC

20

144

Z1231

8

CCCAAATGTACAGGACCGG

19

CGCTTTACCTGTTACAGTGCC

21

144

Z1233

24

ATTTCTAGTGCATTTCTCAGTTTGG

25

CCCATACTGACACTGATGCG

20

143

Z1234

19

CATTTAGATTAGGCCTTCCGG

21

TATTACTGTTTACTTTCAGTGTGGCC

26

125

Z1239

7

AGGAAAGGCCCTGCCTTATG

20

TGGGCTGTACTCATTTATGTTG

22

193

Z1241

2

TGTTCCCAGCAGTGTATAAAACC

23

TACGTGACGCAGGAAAAGC

19

147

Z1243

24

CGTCAAGAGAGGACGACTAACC

22

AAACAGATTTATACCAAGTTTACCTGG

27

191

Z1247

19

GGAGGAGCAGCTCTGCAG

18

GTTAACCACTGAGACACCACTCC

23

150

Z1251

21

ACGCTGAAGGCCCAGACAGT

20

TGTTCTAGCATGATTTACTAGC

22

290

Z1257

14

AAAAATGTCAGTCTTTCATATGCG

24

GAGTCCTCTCAGGCAGCG

18

123

Z1261

18

AGCAGGGTGGAGAGTCTGAA

20

CGGTCTCAGAGGAGATCTGC

20

129

Z1265

6

ATATGTGCTGCTCATGATGAGT

22

AACAGACGAAGGGTGAAGGA

20

140

Z1266

11

GGTAAGAGAATCACGCGCTC

20

GAAACACTCGATGACATTCAATG

23

193

Z1270

9

GCAGGTTTACAGCGCACTGG

20

GAAGAGTTCAGTAACACAAGTCC

23

272

Z1271

19

CCGACGAGACCAAGATCAAG

20

GTGACATCAAGTGTGTATCCGG

22

267

Z1273

9

TAGACTCAATGGGGGAGGTG

20

GTATGGTGGAAATCAAATGCG

21

141

Z1274

21

AGCTGCACATCACTGAGGG

19

GCAGGACGAGCTCTGAAAAC

20

241

Z1276

16

GATCAACCACACTGGCTGTA

20

GTCCTCTCCTGGAGACATCG

20

279

Z1278

17

TCTCCAACGACAACAAACTG

20

ACGTGGAACAGGCTATAAAACA

22

300

Z1295

21

CGCTCGGGATTGAAGGTCATT

21

CTGGAGATATTCACTGAACAAC

22

152

Z1296

10

GCCTCATTTCTCTCGTACGC

20

TGGGTGGGCTGTTTCAGT

18

258

Z1312

12

AGGACAACACCTGCAGCC

18

TGGGATGAGCTGAAGTTCCT

20

139

Z1313

7

TGGGTTTACAGCAGTTTGACGG

22

GGTCCACCGCAACATCCTGT

20

171

Z1322

9

GGACGCCTGTAAGGTCACAAA

21

AGCGGACCACCAGAGTCACC

20

269

Z1348

23

GGGTAGTCAATCTGTGCATCTC

22

CTCACTGGCCACGTCCTC

18

150

Z1351

1

GGTTAGTGATCAGTTAAGCAATTAGTG

27

CTTTCTGAAACAGGGCCAAG

20

136

Z1358

12

TAATGACAGGCTGCACATCTG

21

GGAGCAGGGTCTGAGGGT

18

145

Z1365

12

GCAACCGTTGTGGTGTCC

18

CTTCCAGAGCGCTGTCCC

18

198

Z1366

4

TACTTCAGCTTCATCCAGACCA

22

CTGAACTCTGAGTCCAGACCG

21

119

Z1368

1

TTCTGCATGTGCGAGCAT

18

AGCTGCATCTTGTGTCTAGCTG

22

103

Z1378

25

TGGAGGAATGAGGACAGCAGG

21

ACCGTGTTGACAATCGATCAGC

22

138

Z1389

4

TTTGACAAGTGAGTGTCCGC

20

TAGGACCAGCTTCTGCCTGT

20

177

Z1390

5

TGAGATTTGAAAAGAGGTTCTGC

23

GTTGTGTATGTTACTTCAGCAGTGG

25

146

Z1393

11

AAGCCCATAATCTGAAAACAGC

22

TATACAAACAGGTACTGCTGCTCC

24

200

Z1396

14

TCAGCCACTCCTTCAGTGCG

20

AGCGTCCTTCAGAACCTCATGG

22

150

Z1400

12

CCGCTGTACGCCTTACATG

19

AACCTGTAGAGTCCTCAGCCC

21

107

Z1401

3

TCCACTTCAGTCACGTCCTG

20

CACCATCACCGTCTGGAAG

19

149

Z1402

8

GATCAGGGTGCATGTACTGAA

21

TCTGCTTTCTGTCAGGGGAT

20

185

Z1403

23

CGCAGGTATTTACAGCTCTGC

21

GATCTCTTTTTTCCATGAGTA

21

123

Z1406

2

CGCCCGTTGAGGATACAG

18

CACAGTTCACAAAGCGCACT

20

123

Z1408

17

AATTCTGAAATTAAGATGTTGACCG

25

GAAAACGCACATCACGTGAC

20

101

Z1411

17

GCAGCTGAAACATCCAAACA

20

CTAAAGACATGCAGTAAATTGAGTAGA

27

144

Z1412

13

TCAAACTGCGGCTCTGTTTACA

22

AAGTGCTTTAGCTGGACGAGGC

22

223

Z1416

4

GGACACATGTTGAAACTCTACAGG

24

ACCTGCCCTACCCACTCC

18

136

Z1417

18

GCGGAGACACAGCTCTGAACG

21

TCCAGGATGCAGGCGTTGTA

20

145

Z1419

5

TGGTGGACGAGGAGAAGC

18

ATCTAACAGGTGTCCGGTGG

20

137

Z1422

19

ACTCATGCATGAGGTCAGTCT

21

TCATTAAACAAAGATGTGATGCTAA

25

243

Z1431

25

TTCTCCACATCCTGCTGAGC

20

GTGGTGAACGGCTCCTCTGG

20

150

Z1432

23

ATGGAGACGAGGAGCATCTTGG

22

CAAGGTGCTCAGTGGTGTCACA

22

248

Z1440

17

GTTCCCCTTCCCCACCAGTC

20

TCCTCACTGCTGTGATGGCT

20

250

Z1445

11

CCATTTGTTTAAAAGTTTCCTA

22

CGTGAGTCCTCCACATCATGC

21

113

Z1450

10

AACGTGTGTTCAGGACAGTGGC

22

AGAGGGAAGGTCAGCAGGAAA

21

240

Z1452

16

CAGATTAGCTTTGGCTTCGG

20

GTTTTAATTCCCCTCCAACTCC

22

137

Z1454

5

TTGGAGACTAGAAGCGGGATGA

22

TTTACTGTCATCACGGCAAAGA

22

162

Z1456

21

AGATGGCTGGCGGACAGAAC

20

GAACGACAGCTCTGAGGATACC

22

160

Z1461

6

CAGTACAGTGTCTGGAACACTGC

23

TGTCACGTCAGGTTTATATGGG

22

134

Z1462

25

TGGGCTGTTGGGTCGTTTTC

20

GACGTTCTGCTCCGACAGCA

20

119

Z1463

1

GTGAGGTCATCCAAATAAATCTCC

24

GCATTCAACCCCTGCATC

18

125

Z1473

12

CAACTGGAAGGGCACGAG

18

ACTAAACTGGACTAGTTTGCC

21

149

Z1477

25

CGGCTTCCAGGAACACCTTT

20

TCGTACACATTTACTACAGAAG

22

174

Z1484

2

TAGGCGGAGGAGACCTGCAC

20

CACCCTGATCAGTGAGTGCCC

21

153

Z1487

23

CTACATCACAGGAAGCCAATG

21

TTACTCGTGTAGTTCACCCGC

21

186

Z1490

17

TGGTGTCCATGTAAACGTGCTC

22

GCCAGCGCAACATCTCTGAA

20

135

Z1492

5

GAGCAGCCACTCAGGTGAG

19

AGATACTGCTGGAGGGCTCA

20

246

Z1496

13

CCTGAGCTTCATCCAGAGCTCC

22

CTTCAGTTTACAGCAGCGCTCG

22

222

Z1497

21

AGCGGCTCGCATCACTATAC

20

TGTAGAGCCACTCGACACATG

21

247

Z1498

23

ATGAATGGAAGTCTATGTAATGTCC

25

ATGCTGAGTCTGCGCTTCTGC

21

184

Z1505

4

GAGTGCTAATCTCCGACTCGGT

22

CTCATTAGAATAAACTCTCTGAAC

24

149

Z1523

14

GATCACAGCCGCTTCGTCAA

20

CCAAACCATTCAGACTGGATGA

22

178

Z1525

4

CTTCAGCGCATGTGATCG

18

GACCTTCTCGCTGGACTGAC

20

148

Z1531

13

CATCAGCACTGTGCGTACCT

20

CGCTGCTGCCTTCTGTCT

18

198

Z1535

7

ACATTTCTCTTACTCTAGTTTTCCCTG

27

TTGGTCCAAACCAGACAACA

20

129

Z1536

14

TCATATCTTTATCTCAGAGATGTGCG

26

GCACACATCTGGGGAAAACT

20

199

Z1543

16

CATGTTTGAGCACAGCCG

18

TGTTACTGAGGAAATAGTTGACAAGC

26

128

Z1544

19

ATCGGGAACTTCCTGAACG

19

GATCGAAGCCCTTAGCCTG

19

115

Z1566

9

TCCATCCCTCAGCAGAGC

18

AAGGGTCTGGAAAACCGC

18

150

Z1569

8

GAAAGTAACATGGCATATAAGTCCG

25

CCTGGAGCCTGTGTTTTGTT

20

143

Z1579

23

CTGCCTGCCTGCATATGTGC

20

GACCAGTGGACAGCAACCCC

20

133

Z1584

24

ATAATGAACGTTTGGCGAGG

20

AAGGAAGTCTTTGTGAATTGACG

23

134

Z1590

11

CATGTGGCCACAGCAGAC

18

CAGAGCCAGAGCACTCCTG

19

129

Z1625

19

TGGGATACCTGACATCCAGACC

22

GCTTGAGTGAGGACGCGGTT

20

212

Z1627

13

GCACATTTGTGTGGTGCTGTT

21

CCACCCGATATATTTGCCAAC

21

276

Z1628

19

CAGTATCAGCACACGTGCATGC

22

CCGTATGAGGATGTCCACGC

20

187

Z1632

19

GCGCATCCTCCTCCTCATCT

20

TCAGATCTCCTTCAGCCTGTCA

22

121

Z1634

8

AGCCACAGCGCTGGAGATTC

21

GTGAGTCCAACACACCGCGT

20

286

Z1637

8

GGCTTTTGGATGAAGGTTGAGC

22

GGAATCACAATGGCAGCAGA

20

106

Z1642

16

ACAGGCGGTCAGGAACAGTC

20

AAGGATCCGTCAGCACCGGT

20

222

Z1651

19

CAGGTACAGCAGTTCCCCATG

21

CACGTACAGCGTCAGCCTGT

20

172

Z1652

14

CTGGTAAAGTGTCAGGTTGCGA

22

CGCGCTGGCACCTGCAGC

18

105

Z1653

11

TCGATGACATTCAATGACAGCA

22

CGGGTAAGAGAATAACGCGCT

21

190

Z1654

18

CGTCCAGCACTGCCGACATC

20

CAGCCGACTGAAGGTGTAGAGC

22

167

Z1660

9

TGCCGAGCGCAGAAATAAAA

20

GAGGATATTTGGGTGCACCAAA

22

248

Z1663

9

TGTAATGGGGTATCGGCTGC

20

GCGCAGGCAAACTGCAGTTT

20

260

Z1665

23

AAAAGCCCAGAGCAGTTCTGG

21

GAAAGGATCATGGGTGCGTAG

21

155

Z1668

23

TCAGAACGCTGAGTTTGACCC

21

CTGAGCCTCCAACAATGAAGG

21

236

Z1671

25

CGCTGGCAAACCATGACATC

20

AAGGATCATGTGAAGCTGCCG

21

154

Z1677

5

CCGTGAGAGACGGAGATCATG

21

GACAGGTCACACGGATCAAACG

22

187

Z1680

6

AACGCATTTCCTGCCTCGTC

20

CAGCTCTGGAGATCTGAGGGTT

22

180

Z1688

14

GAGCAGAGCCTCTTACCACTCC

22

TGGAAAAACCACCCTTGGAG

20

212

Z1691

22

TCAGCGTGGGGCGAGCAGAC

20

ACCGGCAGATCTTTGGACAT

20

247

Z1701

6

AAGGATCAGCTGTTCTAACCCA

22

AGGCAGGTGTGAAAGCACCC

20

115

Z1703

2

GCTAGCCAATGTAGTCGAAGGC

22

TTTCCAAGGGGTCAGTGAGC

20

166

Z1705

1

CCACAGCGGACACTTTGAACC

21

CAAGGTTTACCACGGGACTGA

21

146

Z1713

7

TCATTCACTGAGCCTTCAAGGG

22

ACTCCAGACCCTCCATGGTACC

22

149

Z1772

25

GCGCAGGTCATCGCTACACT

20

ATTCATGTTGAACGCCGGAT

20

134

Z1773

23

CATGATGCTGCCCATCGTCG

20

ATTCCTCATGTGGCGACCAA

20

165

Z1774

13

AGACGGAGTTAGCGCTGCTC

20

CGTTCCACAAGCTCAGGGCT

20

168

Z1777

9

TGCGCAAGACCTGGCTGGAC

20

TGGCTGCCTGCAGAATACAA

21

232

Z1778

12

AAGCTGGCGTGAAGAATATTGG

22

CAGGAGTTGATGCCAGCGGG

20

182

Z1781

1

GCTCTGGCAGATTCCAAATTCC

22

AAGGGTCAGCTGCAGGGGT

19

196

Z1786

16

ATCCGCACCGGCCTGGTGAA

20

AGAGTCACCTCCGCATCTGC

20

201

Z1795

18

TGGGGTCCAGCCTTTGCTGA

20

GCTGCACGCCACCGCCTACT

20

189

Z1796

14

AGACACGGGACAGCTGGGTC

20

TAGTTGGCGGTTCATTCCGC

20

228

Z1798

7

ATGGCATGCATTTTACTAACGG

23

CGAATCGTGGCCCTGACCGT

20

129

Z1799A,B

19,25

AGCGCTCCTCCGTCTGCTGT

20

TCCGCGTCCATCACTGCGGG

21

228

Z1801

14

GATCACTGAGGAAGCGCACC

20

CCATCAGTATTTCAGACACCGC

22

189

Z1803

19

CAGAACCCTGCTGTTCCAGAA

21

AGGTGCACCGTCTGGATCTT

20

184

Z1804

12

TGCATGGCCGTGTTCGTAAC

20

TGCTCGACCTCTGAGCCTTT

20

139

Z1805

9

AGTAAAAATGGGGTGCGGCC

20

CTAAGGGCCGTGCCAGAGGC

20

133

Z1806

21

TCACTGAGCCGTAAACCCTCG

21

CTGTACCGTCGCTCTGCGCT

20

159

Z1812

14

TAAATGGCCATGATTGTCCGC

21

TCCAAGTTGTCTGACTGGGGC

21

145

Z1813

5

GGCGCTCTCTACTGGCCAAA

20

TCAGCAGGGCCAGTTCACAT

20

122

Z1818

14

TTCCCGCCACAACCCAGTAT

20

ACTGATCAACTACACTGGCCGC

22

129

Z1820

9

AGCAGAATCCTGCCCATGAC

20

GCTGGAAAGGATCACCACCG

20

138

Z1826

13

CGCCACTGTAACGCCACTATAA

22

TTGAAGACTCCAGAGCCACAAA

22

150

Z1830

9

TTGCGACGTCTGGACGAGAG

20

CTGTGGCAACCCCGGATTAA

20

166

Z1837

16

GAGGCTGGCCTCTGTCGAAA

20

TGATTAATCTTTGCCCAGCACT

22

211

Z1842

5

AGCACCCGGAGGAAACCAAT

20

AGCCAAACTCTCCCAACAGCC

21

196

Z1928

17

GATGACGACATGAACCTGGGC

21

CCACAACACCCTCCAGACCC

20

256

Z1984

25

CTGCACAAACAGGGTTGCGT

20

CTGCATTGCATCATGGTCTCC

21

132

Z1985

17

ACAGCAGATGCCCTTCCAGC

20

AGTTAAGGTGCTGCGGTGGC

20

118

Z1986

1

GCTGCAGCGCTGGTCACCAT

20

GCTGTGGCGACCCTGGATTA

20

138

Z1990

17

GGGGCTAATCTCAGGCTAAACC

22

TGCACCATCAGAGGCTGCGA

20

167

Z3008

7

TGAGACATTGCCTGATTAACTTA

23

AGACACCGGGGCACAGAAGA

20

255

Z3011

6

GCTGTGAGTGACTGCTGGGC

20

CCCTTACACCGAAAGTCAATGC

22

86

Z3023

19

AGTTTCATTGTCCAATCACTGTAC

24

GGACTGCAAAAACTTTGAAGCTC

23

172

Z3025

4

CCCAGACCTTCTGATCCAGGC

21

CGCACTTTCATCTACAGCTCGA

22

111

Z3028

7

TAAAATAAACCCTGCAGCCGTA

22

ACTGAGCCACCGTGCCACCC

20

250

Z3056

22

GCTCAGTGGAAAAACAATGAAAG

23

CGCGCTTAAATCGATCAATGC

21

177

Z3057

7

AGTCTGTTTGGCCTCAGCGC

20

TCTTGGCGACTGAGTTCTGGG

21

177

Z3060

5

GCCAACATCCTGCAGATTTTAA

22

CAAACCTGGAGGACCAATGTCC

22

188

Z3065

25

GGTTGCAGCTGGTTGCACTG

20

CCATCAAAACTGCTGTGCATCA

22

149

Z3072

16

TTCCCGTCCGAACCAGAATC

20

GGAAACCTATGTAATGTCCCCAC

23

171

Z3077A,B

23,2

TTAGCATAAGCAGCAGCCCTG

21

AGCGTACAGCCGGGGTTAGA

20

153

Z3083

8

ATGTTCGATGTTCTGCACTTGC

22

GCTGTGAGGCGAACGTGCTA

20

113

Z3086

19

CGAAATCCCCTGAAATCTGCC

21

CACACTATGCAGCTCAGGGGC

21

101

Z3091

14

CAAGACCCAAAAAGTGCATTGC

22

CAAGTTCAGTGGGCCTGCCT

20

149

Z3093

22

GTCAGTTGGTGTCCCCCCAC

20

CAGCACAGGTATTATGCAGCGG

22

136

Z3099

1

TTCTCCCGGAGTTTACATGCTG

22

TTTGGTTCCTGTCAGATGCCA

21

247

Z3100

3

ACTCGCATCACAATGCTTGAGC

22

TCCTTTCAGCAGGACTGGGC

20

189

Z3104

16

TCCTTTGGAACAAGAGTGACCG

22

CACCAAGCGATATGTTTCCTTT

22

255

Z3123

17

CCTATGGGGAGTCCTGTGAACC

22

CTTCTGGCCTGTGCGGATTC

20

143

Z3124

9

CGGCTCCACAGGAACATGAC

20

GCCGATGCCATTTTCTGTCC

20

149

Z3126

16

ACCAGATTGGCAGAAACACC

20

GTCTGCATCACGCTGCAC

18

234

Z3157

23

GAAGGGGTCCTGGATTTGTTCA

22

GACACAAGTCATTGGGCAGGG

21

127

Z3165

17

TCAGATAATGCAATCCTTGGC

21

TTGGTCATTGGATGCAGAAA

20

206

Z3193

5

CAAGGCATACCATGAGGGAAGG

22

TTGTCATCCGTTATGCCCTCC

21

135

Z3208

25

CAGTTCTTACTCACCCGGGCA

21

TCACGGCCGTCTCTCATTCA

20

236

Z3211

20

AATGTGCAAGAAATCCACAGC

21

GAGGTGAGAGCCAAGAGCC

19

135

Z3214

24

CGTCATTGTGAGTCACTGCTGA

22

TTACACAGCCCAGCAGTCCG

20

118

Z3218

11

TTTCACTTTCGGAGTTTGCATG

22

GCTGGAAGACTGGAAACATCCA

22

174

Z3219

4

AGCGGCTGTAGATGTCGATGC

21

CCGTGTGTGTGCACATGACC

20

131

Z3232

18

TCACCCTTTGGCCATGTTGT

20

AGGGGCCCTTAAGTGGACTCC

21

239

Z3259

14

TCTCAAAAGCAGATCAGACGCA

22

TCCACAGCGATAGTGCCCAA

20

142

Z3260

10

GCTGGTCTTCATCCCAGAATGG

22

TGGTCGGTGAGTTTTTACAGCC

22

227

Z3273

7

GCAGACACAACTGACGCATT

20

CACCCAGATGTGATTTGCTG

20

161

Z3275

4

TTATTAACACAGACAGCCGGG

21

CAGACAGATGCAGACCCTCA

20

204

Z3286

22

CCACACATAGTGGAACCTGCTG

22

CTGGAAGTTACATGGAGCGTCA

22

100

Z3290

14

TCCTGGGTGCACAAGAAAACTG

22

GTCCCCACATCCTCGCAAAC

20

187

Z3309

15

CATCCTTCCACACATCTGCAGG

22

TGGAGCTAGCCAGAATAAGCGG

22

105

Z3310

24

GCCCCCTTTGTTGATTCATTC

21

CAGCCCACTGAAACTCGCAA

20

150

Z3314

5

ACACGCTCATTTCCCCCAAA

20

ACACCCGAACCCTCCCAAAG

20

110

Z3321

12

AATACGCAAACCGTGAGGAC

20

TGATCAGTGTCGTAAACCTTGA

22

133

Z3324

22

AAATCAGTGTCCATAGGCCG

20

TGTGATGCATCAGGTATGAACA

22

126

Z3332

21

CAGCACTGCACGTGAACCAC

20

CTGGGAGACTCCATCAGTGCA

21

150

Z3334

5

AACAGGGGGCTAGCAATTCT

20

TGCACTTTTGAATGACGACA

20

136

Z3358

15

GCCTTCATCTCGCCACTGGT

20

CGAATTGTTGGGTGAACTAGCC

22

187

Z3362

11

AAGAAGCCCTGAGGACAACA

20

GCCATTGACTGTGCCTGAG

19

152

Z3368

6

ACCCGCCTCCTGATGAACTG

20

CAGCTGTGGAACAGCGCATT

20

169

Z3376

25

TGGCCTCCGTTACATTTGCA

20

AAATCCAGGCTCAAACAGGTCG

22

194

Z3384

19

TATTAGAGGTCTGCATTTCCG

21

CTATTGCACAGACAGCATCACA

22

141

Z3399

24

CTCCTAGGGTGCTCCGCCTT

20

ACAGCAGATGCCCTTCCAGC

20

198

Z3405

25

TCAAAATGTACACCCACAGCGG

22

CCTGCGAGTTCGCTGGAATT

20

259

Z3412

11

AGGCAAACAGAAGCATTTGGC

21

GGAAAGTCCAAGTACCTTGCGC

22

134

Z3417

1

TGAAAATAGGGTGCGTCTCCTT

22

GCGCACATCCATTTCTCGTG

20

134

Z3424

13

CTGAAATCCCATGCGATAAGGC

22

ATACCCTGCTGACCAGCGGA

20

215

Z3430

2

AGAAACGCAAACGCCCACAT

20

TTTAAATGCAGCCCACGGCT

20

113

Z3439

3

CTGCAGCGAATGAGCAGGAA

20

TTGTGAGCTCAGGTGGCCTG

20

123

Z3445

7

TTGGGAGACCTACAACCCAGAC

22

GCGTCTCTGGTGGAGGCATA

20

120

Z3455

10

GGGTGGGGTGAGGGCAATAT

20

AACGAGGCCAGTCAGTAATGGC

22

162

Z3467

12

ACTGCGTCACCTGTATGCCTG

21

TCTGGGGACTGATTCACAGGTG

22

147

Z3476

21

GGAGAGCTGCACCGTGAACA

20

GCCGGAAACCGCAAGTGTAG

20

208

Z3490

25

TCTAGTCGGTCCTGAGGCGC

20

GCAGGAAACATTGCATGACTCA

22

141

Z3516

5

GCACATCAGCTCCTGTGAGAGG

22

TTCGCACATGCTAAAACACACG

22

107

Z3525

23

TTCTCTGCGGGGTGGTTTTC

20

TGCTTTTTCAGGATTGCAGCC

21

149

Z3526

8

AGCTGGTGTATTTCGGAGAGCA

22

CACACACTGACGTGCGGATG

20

253

Z3527

11

TTCTGGTGTTTTCCAGCGGA

20

GGCAGTTCGTCACCTCAAAACA

22

226

Z3528

25

GCCAGAGGCTGATTGATAAACC

22

ATGTGGCGCTAAGCACTTTTCC

22

150

Z3532

23

AGCCATATCGCACTGCTACTCG

22

CCTCCCTGAGCTCCCGAAAT

20

264

Z3551

2

TGTGGAAGGAGCTGTAGATGGA

22

TGGGTGGAGTTTATTCAAGCCT

22

244

Z3558

18

GTTATTGGCACCAGCCAGGC

20

TGATAGTCCTGTCGCCGCAA

20

243

Z3561

21

ACTTTGAGGGATACAGACCGCG

22

AGGGAGTCACTGTCCCTGCG

20

144

Z3579

22

CGCAAATCAAATCAAAATTGCA

22

GCAGGCCAAGTGCCTTAATG

20

206

Z3581

6

TTCTGCTGTGGCAACCCCTT

20

AGCTCATCCCTTTGGCAGATT

21

210

Z3602

4

AGCATTAGTGCATTCTGCGCA

21

TTCCGATCCCAAAATTACAGCA

22

107

Z3606

19

AGACAGTTTGTGTATGCGTGCG

22

AATCACTCCTCATTGGCTGCTG

22

158

Z3626

13

GGCAGAACAGCAGGACGGAT

20

CAGCGGGAGGTGTATGGAGG

20

145

Z3632

25

GCCACACTGAAATGGTCTGTGC

22

GGGGATGGTGGGCAAAGAGT

20

203

Z3633

16

GCATCCTTTTGTTTGCATGTGC

22

TGAGATTTGCGCTTGTGGGA

20

185

Z3651

9

TGTTGGAGGAGTTGACCAGGTG

22

CAGATCCTGCCTGACCTGCA

20

132

Z3664

13

CTCCGCTCCGGTACAGCACT

20

GATCTCAGAGCAGCCGACAGC

21

114

Z3668

7

TCACGTAATTTCGGGTGTTTCA

22

TCATGTAGGACTTTTGCCGCG

21

101

Z3680

23

CAGCTAGAAGGGCATCCTCTGC

22

TGGGGAAAAAAGGGAAACGG

20

156

Z3690

12

AAGCCATTCCTTCCATTCTTCA

22

CCCCACAATTAAAGCTGACAGG

22

182

Z3703

14

CTGTTTGACGTGTCGCCCTG

20

AGCCGTGTGGATTACAGCACA

21

247

Z3705

9

TTGTGATTTTTGGGCTTAGGGG

22

TGTGCACCGTACTGTTTTTGGA

22

150

Z3712

23

TGCTGTTTCCCTGAGACAGTGG

22

AACACGAGATCGGCCTGTTTG

21

143

Z3714

11

TGGCTGTGTTCATATGGTGTCC

22

CACAACGCCATCTGACCCAG

20

201

Z3725

3

ACTAAATCGCACTTCAGCAGCG

22

GGTGTCCTCACATCAGCTGCA

21

256

Z3735

15

TCTGGGTGAGCCAGAACATTTG

22

TGTGCGCATGTAGGCGTATG

20

179

Z3741

16

TGCCAATAAAGCACCTCAAACA

22

GACACCTAGCGGCACAGCAG

20

130

Z3743

2

CATTGCACATGCAGCACATAAA

22

CTCATGGGGACTGAAAAATGCA

22

205

Z3745

25

AGAAGACGGTTCCCCATCGC

20

AGTAACTGACTTGCTGCCGCG

21

141

Z3754

2

TGTTTTCTTGAGCCCTGCTGG

21

CTCTCGAAAGAGCAGGTCGAGG

22

108

Z3760

15

ACATGGGTGCTCAATCCGCT

20

TCCTTCCCGAACCATCCAGA

20

103

Z3763ABC

18,5,9

CCAATTAACGGAAGTGAACCGC

22

GCACTGGATCAGTCCCGCTT

20

147

Z3766

1

ACGCCTGCATCTGATGGTCA

20

TCCATGCACAAAATCTCTTGCA

22

168

Z3770

19

AAAGCCTGAGGGACGCACAG

20

TTCAGTGAGGGGTAACGGTGG

21

145

Z3782

19

AATTCTGGGGGGTAATTCTGGC

22

AAGGGGGCTAAACCTTCAACTG

22

115

Z3784

9

TACGCTTGCAGTGTTTGCAGTG

22

ACGCCGTCTGGCATCAAACT

20

150

Z3794

23

CTGAAGCAGATGGCCCAGAC

20

ACCCTCATTCACAATCCTGTGC

22

207

Z3801

12

GGTGCTTGTCACATTCCTGCA

21

AGGATGGATGTGAGCCTCTTGC

22

181

Z3804

5

CACGTGCTCAGAGCTCCAGC

20

GTGAAGCGCGTGCACATAGG

20

203

Z3815

25

TCATACCAACTGGTCAGCCTGG

22

TCGTGGGGCTCTATTTCCTTG

21

142

Z3816

19

AGATCAGGTGCACAGTGGCG

20

CCACTGAAGGGCAAGTGGCT

20

189

Z3824

20

CCGCTTAGATGTGCATTATCCC

22

TGGCATTCCCGTTTAAAACCC

21

224

Z3835

10

TCACCATTTTCACAAATTGGCA

22

AAATGGAGATTCCGCTAAAGCA

22

153

Z3837

1

TGACTGCTGGAGCACAGATGC

21

GCATTTCTGAACAGCCCTCC

20

121

Z3838

18

CGTAAATGCAGAAAATTGGGCT

22

ATGCTTGAGCCCATGAATGG

20

250

Z3852

23

CATATGGGGCTCCATCTCATG

21

AAGCTAAAGCAGTGTGCGGTCC

22

153

Z3853

18

TCCCTCACAGCTACTCAGCAAG

22

GAGGCCAAGAAAGAAATCTCGA

22

150

Z3863

5

ATGCAAGCATAGATCCGACACA

22

TGTCGGATCGATGCTTGCAT

20

191

Z3868

14

TGCTGCTTATGTAGGTGGCAGG

22

TGGATGATTGTTTTGGACTGCC

22

151

Z3872

14

ACATCAGGAAGGCAGCTGGG

20

AATGCACACTCGCCTCCTCC

20

160

Z3885

8

TCCTTGCGAGAGCAAACGTG

20

CTGGGATCCACACAATTCCTCC

22

145

Z3892

18

CGCGCCAAATCATCTTTCCT

20

TTCACACACGCTCACGTCCA

20

139

Z3894

17

CGTGAGGTGGCTCATATCAGG

21

CTGACCCACACCTAATGATCCC

22

265

Z3901

24

GTCCAATCCCTCAAATCCCTCC

22

TTGAACCTGCAGTGTGAAGCG

21

286

Z3902

5

GCCACCATGCCACCACATAA

20

CAGGCGAGCCTTGGAAAGAA

20

217

Z3929

3

ACCAGGTGAAGGCATACAGG

20

ATAAATCAGGCTTTAGAAATCCG

23

131

Z3952

11

CAGTTTCACAGCCGCATG

18

AGCAGCAGGTCAAACACTCA

20

179

Z3953

1

ATGCACATTACAACCTCGAGG

21

ATGTGTTCGCTATTTCCATGC

21

279

Z3954

20

AATGGTGTAGAAACCCTGCG

20

AAACGCACTAAACATCTCTCTTG

23

277

Z3964

20

GCCATTTTTCTTGCTGCAATCA

22

TGCATGCCATAACAAACACTGG

22

275

Z3969

13

CCCGCAGCCTTTCAGACACT

20

AGTGACAGGCGCGCTCAGAG

20

203

Z3984

14

TGCTCATGCTTGAACTCTGCG

21

TCCACAAAAACCACATGATGGA

22

139

Z4003

23

AGCAGGGGGATTCCTGCATT

20

AAGTTGGCCAATATGGTCTGCG

22

225

Z4009

19

TAATGGTTGCCCCGTCCATC

20

TCATGCTGCAAACCCCAGTC

20

281

Z4020

21

AAAACACGCACCCACAGCAG

20

CCGTGCGGTTCTGCTTATGA

20

122

Z4025

4

TGTGTGCTCACTGCTGCTGG

20

CTCAGAGCGCTGGTCAACCA

20

168

Z4053

17

TGGCGACATCTGCGATGTTT

20

GGAAAGCGTCTGCCTCACGT

20

213

Z4074

21

CAGAGTTTATGGGGATCAGCGG

22

GGCCGACACAGTTACAGGCC

20

174

Z4075

23

CTACCCGCACCACTGTGACG

20

CGCCATCGGTACATCCACAA

20

306

Z4076

13

ACTGACCCACAGCTGGTCTGG

21

TCTCAGTCGTCATTCCAGCTGC

22

254

Z4077

8

TTCACAGCTTCAGTCCTGCTGG

22

TCACGTCTCACCAAGAACCAGC

22

181

Z4082

21

AACCACCGACTTCCATAGCAGG

22

AAAGGCTTGCAGCGCCATCT

20

226

Z4120

23

TACAGCTGCTGCGTGATGAGC

21

TCTGTAAGGAGTGCCTCAGGGC

22

145

Z4147

12

TCAGTTTGGACTGAGGAGCGC

21

TCAGCACTACAGGGACAGCAGG

22

147

Z4157

20

GGATGCGCAAGGAGAATGCT

20

TTCAAGCGCGAGAGAAAAACG

21

186

Z4161

3

ATCAGTCCTGTGATTCCCGTCC

22

CCTCAAGCGCCAGCGAGTAT

20

325

Z4168

9

GTGGAGCATGCATATTCTCCCC

22

TTACACAGCGGAAGCCCTGC

20

195

Z4175

16

GCTGATAGCCCCTTTCAAACAC

22

GTACGGGGCACCTCCATCAG

20

119

Z4188

12

GTAGTTGAATGCCGAATTGGCC

22

GAACACCTGCGCATCCACAG

20

207

Z4190

11

CCATGGAAAAGGCTGGTTATGG

22

TCCACGTTTCCAGGTGAAAATG

22

125

Z4192

21

CATCCTCAGCACCCTCAGACTG

22

ACTGGATGGAGACCAAGCGC

20

371

Z4198

25

GGACATCCGCTATATGGGTGAC

22

TGGATGCCCTTTCAACTGCA

20

123

Z4203

14

AAGGCTGTTGTCCTCGATTGG

21

TCCAGCGCACTGCTATGAGG

20

213

Z4207

11

TGCTCCCATCATGGCAAAGA

20

GGCTGGCTAATAATTCAGGGGA

22

204

Z4221

11

GTGTTCCTCTGGGAAACATCA

21

ACAGCAATGGCAAGTTTCTG

20

228

Z4229

9

AGTGATGACACCGCGTCTGC

20

GAACCCACAGGCCGTTAAACC

21

148

Z4246

5

CCAGCACCTTGTTGAACCTGG

21

GCCGGATTTCCTGGAGGTCT

20

218

Z4252

13

TGTGCGTTTGCAGTGCTCTG

20

GGTACTGCTGCCGCTGGACT

20

120

Z4259

12

ACCACGCTTTTTGTGGACTCTG

22

AGGGGGGAGAGCATGCTAGG

20

352

Z4263

18

AAGCTTCACGCCAAAGACTGTG

22

ACAAGCACACCATTGCTGCA

20

314

Z4268

17

GCTGCGTTACTCACCGAGAGG

21

AGCCAGCTGAATTCCTGAAAGC

22

205

Z4278

2

ATCCTGTCCACTGCTGCATCA

21

ACATTGCTAATGAGTGGCGCC

21

147

Z4284

22

TGATTGGAAACCGTCGGGAT

20

TGATGTTGCAAGGACAGGAAGC

22

147

Z4285

13

TGCATGATATCCCACAACCCC

21

GACCCTCCCCCTATCTGCGT

20

120

Z4289

2

TCATTCAGTGACTCCGTCTCGC

22

ATGCAGCCCTCAGACGTTCC

20

242

Z4291

14

TTTGCTCCTCTGGACAGCACC

21

CCCCGAGCAGCATCACCTAC

20

147

Z4294

25

GGCCTGTAGAGCAGCAGAAAGC

22

TCTGCTGTGGAGAATCAGCTGC

22

236

Z4297

6

AGACTCACCATGGCTTGCTCG

21

TGTGCAGAGGAACAGCCCTG

20

163

Z4299

5

AGGAATGCGCTATGGGACGA

20

CACATCTGCCACTGAACCGG

20

198

Z4300

2

TTTGGTGCACAAATGAAGGCC

21

CAAAAAGGGCATCGGTGCAT

20

149

Z4304

20

TTAAACTCCTTTGCTCGAGCCG

22

CAGACATTGCCTGAGGATGCC

21

134

Z4314

17

GCACAAAACCTCACATGCGG

20

GCTTCACCGTACCCACAGGG

20

234

Z4318

8

GACCTAATAAAGTGGCCGGT

20

TGGTGAAAGCGCCCATCTTT

20

149

Z4323

8

TCTGTCCTCTCGTCCCCGAG

20

AAATTAGCACACGTCGCGCA

20

148

Z4325

12

GAATCACGACTGGCCATCTGG

21

GGAGCCGTGGAGCCTACAGA

20

129

Z4329

20

CAGGTGGAACATTTCCTTTGCC

22

GCCTCCAGACAGAATGCAGC

20

166

Z4332

17

TAGGGTTGGGGTAGGGCCAT

20

TGGAATTGGAGAACATACCCCA

22

175

Z4339

6

TCTCTCCGTGAGTTTCCGCC

20

CATCTCCATTGTTTCTGCTGGG

22

318

Z4348

5

GTCCCATGTTTAGCAATGCCG

21

CATCTCCATTGTTTCTGCTGGG

21

286

Z4349

2

GGGTAATGAAGCGTTTCTGTGG

22

CTCCGGAGATCAGCTTTGAGG

21

149

Z4353

11

CGCATACATTTGTGCATGGTTC

22

TGGGGCCTCCTTCAAAATCA

20

182

Z4358

25

AAAGCAGTGTAGTCCTGG

18

AAATGCTAAATCGTCTATGT

20

155

Z4373

12

AGCTTTGAAATTAGAGCG

18

ATGAGTCAATGTTCTGCTC

19

199

Z4374

19

GCATCTTGACTGTGAAAGT

19

TTCTGTTGGCTATAATAAGG

20

218

Z4375

7

CAATTTGCTTCTGATTCA

18

ATAGAGATAGGTCAACAATCG

21

240

Z4378

18

AACTGTATGATCGCCTTAAC

20

ACTTCCTGTCTAGTGTCTGATTAT

24

124

Z4379

19

TCACACGCCGATCCACATTT

20

TGAATGGTCCCGTTTGTCATT

21

150

Z4382

2

TCGCTGGAACCACCATGTTG

20

ATCTGAACCGTCTGACCGCC

20

238

Z4394

20

CAGCGGTCTGAAATTAATCGGC

22

GGTAACAGGACAGTGCCACCG

21

235

Z4396

15

GGGATTGTGGTTCTCCACGC

20

AGGCAGCCCTTTCCTAAAGGC

21

149

Z4397

12

TTGAGGGGAAACAGAAGCAACC

22

TCACCCGATTTCCCTAACATCC

22

254

Z4409

22

TCGGTCCAGCACATAATCAAGC

22

AGCCTTGGGAGAGGGACTGG

20

149

Z4410

9

TGCATTCCTATCCATGTA

18

ACTAGAGGGCAGAACAGATC

20

283

Z4421

23

TACTAATGGCCCAGGGCGAG

20

ACACCCTCCTTCACACCGGA

20

208

Z4425

21

ACACGACAGGAGGGGGAGGA

20

CCCAAATGGCTGTGCTACAGG

21

152

Z4437

24

CGCCCACAACGCCATAGAAA

20

TGTCCCGGTAAAAGTGAAGGTG

22

380

Z4469

2

TGAAGCACATTTCAGACCTGCC

22

TTACCAAAGCGCTAGCATGAAA

22

172

Z4492

21

ACCTGAGTGGTGGCAGAAGACC

22

TGGTGCAATGTTGACTGAATGA

22

122

Z4499

12

AAAAGGAGCCATGTGGCAGC

20

ACGGCTTGACATGGCACTCA

20

266

Z4507

7

TCACCCCATATCACTCCACAGC

22

TTCGGGATCTGCAGCGTGTA

20

239

Z4543

16

AGGCACGCTCGCTTCTGTTT

20

AAGATCAACAGTAGCCCTGCGC

22

230

Z4544

9

AATTGGGTAGGCTAAGTTGCCC

22

AATCCAGGGTAACCACATTGGA

22

150

Z4567

25

CCCAAACAGCGGCACCTTAG

20

ATCCCAGTCCCTTGTAACGGTG

22

175

Z4568

12

TCTCATTCAGACACTCCGGCC

21

CCCTTCAGCCGGCATAGAAA

20

150

Z4577

9

TGTGTGCACCTGACAGCAGG

20

GTAAAGAGCCTGCCTACCCACC

22

331

Z4583

13

TTGCTGCCATGTGATTGGCT

20

TTTATTCCTCTGTGGTGACCCC

22

198

Z4585

2

TTGTCAAGTGTGGTTTCACCCA

22

TAGCTACCCGCTGCATTGGG

20

174

Z4586

2

GGTCCTCCAGGAACATGGTTG

21

TCTGCTGCAGGTCAAACAGAGC

22

205

Z4592

14

CCTCTGACTGAACCGAGTACGG

22

GCGCAGTTCACTGGTTTAACCC

22

113

Z4593

1

GCGGTCAGTTGTTGATCAGTGC

22

CGTGCATGAAGCGGAAGATG

20

171

Z4627

20

GGGTGATGTGGCCAAGGTCT

20

AAAGGGGGACCACAGTTTGAA

21

274

Z4634

12

CGCAATACTGAAACACAGCAGC

22

AACGGGTCAGTTTCAGAGAGGC

22

246

Z4637

8

ATCAATGGATTGGACATGGGTT

22

TCTGTGACTCTACAGCGCCCC

21

250

Z4640

17

ATTGTGACATTTTTGCATCGCA

22

GCAACCCATCTCTGGGAAACA

21

149

Z4641

2

AGCGACTCTGATGAGCCAATCC

22

ACCTCCTGCACCTCCACGTC

20

248

Z4662

2

TCCTTTTCAAGGCAGTTGAGGC

22

AAGGCAGGAGGTGAGGACAGC

21

248

Z4664

14

TCCCACATCTTCGCAAACAG

20

TCCTGGGTGCACAAGAAATCTG

22

180

Z4670

16

AGCGCTGCATACCAATGCAC

20

TGGTGGGTAGAAAATGCAGCA

21

147

Z4673

9

TGTGAGAGACCAAACAGGCAGA

22

TCTGCTGAGGCTTTGCAGTAAG

22

262

Z4678

16

ACACAATGCTTTGGTATGCTGG

22

GGCGAAACCAGAACACCTGG

20

150

Z4682

22

AAGCCTGGCATTGTTCAGTCTC

22

TGCCCGTCAGGAAGTCTTTAGG

22

291

Z4693

25

CAGCGCTTGATTCTGCCTCA

20

TCTGCATGCTAACCGAGGAGC

21

223

Z4701

14

ACAGGAGCGAATCTCACCCG

20

CCAACCACAGGTATCCTGAGCC

22

261

Z4706

7

AGCTGGAAAGCCAGATGCTCA

21

CCCCATCAACAAAGCTCTTGC

21

188

Z4717

18

AAGGTGAAGTGTGTGGCCTTCA

22

CGTGAGGTTTGCTGTCACGG

20

216

Z4718

21

CATTAATCCAGCAGCGGATGC

21

ATCCATGCGCAAACGTCTGA

20

250

Z4733

2

CATTCCACTGTGGCTTGTGACC

22

AATTGCCAGATGGCCAGTCC

20

137

Z4738

10

CACAGCGGATGCTCTTCC

18

GTATAGGGGAACTAAATCGGCC

22

150

Z4760

5

AATGTCAAGGACGCATGGCA

20

CAAAGACCCACACGAATGAACG

22

253

Z4761

6

GGTGAATAGGGCTAAATTGTCA

22

GCCAAAAATACATTTTGGATTT

22

238

Z4764

1

CCCCTAACTGTTGACCGGTA

20

AAGAGTGAGTCTGGGTCTCCTG

22

247

Z4768

22

AGCAGCCCTGGGATTATGAGC

21

GGGATTACATCCTGGTATCGCA

22

151

Z4773

21

CATTAAACATGATGACGGCG

20

ACCAAACGGAGTGGATGAAG

20

218

Z4777

23

CCAGAGACCTGGGTTCTATCC

21

TTACATTCATGTCAGGGTCTGG

22

364

Z4825

19

AAGCTGCATCCCATCACTG

19

AGAACGGCTAAATTTGGTTGG

21

245

Z4827

21

CCCGCTAACAATGGAGAAAA

20

ACACGCACAGGTGTCATGTT

20

217

Z4830

12

TGTTTCCTTTTGCCTGTATGG

21

TTTGGGGCAATAGGTGAAAG

20

194

Z4847

12

GTTGGCGGTTTATTCCGCTG

20

TGGTTCCCGCACATGACAGT

20

132

Z4853

17

AATGAATTTTGGCGTGGCGC

20

CCTGCTGTTGCAACCACTGA

20

399

Z4862

17

ATGACCCTTCTGTCGGAGCG

20

AGCCTGTCACCATTCACTGCC

21

177

Z4875

2

CACTGGGGTAAGGTGACTGCG

21

TAGATATTCCCCCAAACCGCG

21

247

Z4896

14

AAGCGCTTTGAGTGCCCAGA

20

TTTCCCTGTAACAACAGCACGG

22

139

Z4910

21

TTGAGGGCATCCGCTGTGTA

20

TGAGTGCTTCAGCACCCTGG

20

362

Z4950

6

AAACGGATTCACAGACGAGCG

21

TTCATGAATGAGGCCCACTTTG

22

186

Z4951

4

TTCCTTCATGGTGGGCGAAT

20

CCTCTCGTTTGGAGCCCAGA

20

251

Z4956

8

GGGGAACGGAGGTCGAAATC

20

GTTGCGAGCTCCCAGCAAAC

20

263

Z4999

7

TCGCTGGTATGACAAACACGTG

22

GGCAGACAGGCAGAAAGGGA

20

185

Z5022

16

GCCAATGGCTTCAGTTTCCA

20

TGAGCAATTGGTGGCTTACTGC

22

146

Z5024

1

TGCCGTTCAGGGACTTCAAA

20

ATCTGGTGGCTGCCAAATAACA

22

150

Z5030

25

CAGGCTTTTGTCTGCAAACTGC

22

GCCTACATCTGCCCAAAAATCC

22

121

Z5033

3

CACCAGGAAGAAATCGATGCG

21

GACGTTTACCCACCAAGAACCC

22

253

Z5058

1

CTGACGAGAACGGTGAACATGC

22

GCTCAGGGTTTGGAGGATGTG

21

185

Z5073

25

TGCAGTGAACCCCACAGAGC

20

GATGTCATGCACCCCAGTGG

20

139

Z5075

24

TGTGTTGTCTGATATGCCCACA

22

TGCAAAAAGCCTCTAAGTGCCG

22

234

Z5080

9

AGAACACACACAGCGTGACCTC

22

ATGGGAAGAACACCCCCACG

20

111

Z5081

8

GCCCCCCTGAATTATTAGCACC

22

CGGTGAAGTTACGGTACCATGA

22

211

Z5095

4

GTTGGGTTTAGGGGTAGGCTGG

22

GCGCCCCAAATGGTTTTGTA

20

208

Z5112

4

CAGCGACGCTTCAGTGCTGT

20

CCGGGAGAGTGAGATGCTGG

20

247

Z5141

23

GGACAGTCTTGCCTGACAGCTG

22

CAAGTGCTGCCATCAGCATACA

22

111

Z5160

23

AAGCGCTTTGAGTGCCCAGA

20

TTTCCTGACCCGCAGTCATATG

22

148

Z5167

4

GCCCTTGGAACAGTCACATTCA

22

TGCAAGCCATCACTGGGAAA

20

342

Z5179

12

CTGAGCTGATGCTGGAGCCG

20

CGTCCATTCGCAGAGCGGCT

20

218

Z5180

16

GCGCCGCTTGATAAATAAGGG

21

GGTTTACACAGCGGATGCCC

20

141

Z5183

19

ACAATCACTTTTGCTCTGGGCC

22

CCGCCATTGCAAACAGTCAC

20

143

Z5188

13

GCCCAAAGACATGCGCTATAGG

22

GCTGGAAAGTGGTATGGCCG

20

239

Z5191

15

AGTCAGTCAACCCATGCCTGC

21

CGCACATGTGGTTCCCGTAT

20

149

Z5195

14

AGCCCTCCAAGATTTAATCGCC

22

TTAAATGCGCCGAGGCAAAT

20

221

Z5197

3

CCAATCTGCAAATGTCACCAGG

22

TGTGCACAGCCGTTCCTACA

20

151

Z5208

5

CCAAGCAACTTGAAATTTGCCA

22

TGCTGTAACCACTGAGGTTGCC

22

347

Z5223

15

AACAGAGCCGATCTGCCACC

20

AGCACAGCGGAGGAAATAAAGC

22

150

Z5229

25

TCCCGCTATTCTCAATCATCCA

22

GCGTTGTTAACCTGCACCTTTT

22

139

Z5231

18

AAAGTTGGGTTCATGTTGTGCG

22

ACGGATCACATCAAACCTGTGC

22

146

Z5238

22

TTCCAAATGTATTAAGGGGGCC

22

GATAATGGCCAGCGACCTAAGA

22

224

Z5260

5

CGGCGTGATGAGTGCAAAAC

20

CGGCTGTTTGTGTCAGAGTTGC

22

261

Z5265

23

CTAACCACAGCTGCAACAACCG

22

AGTGTCCGTGCAATCAGAGGC

21

177

Z5294

6

AGGGCGGCGAAATTGAAATT

20

AGCTCTAACCCCCTCCAAGCA

21

343

Z5297

14

GTTCATTCCACTGTGGCGACC

21

AGGATCCAACACCAACCAGACC

22

305

Z5321

18

TCCTCCACTGAGGTCACTTCCA

22

TCATAAATTAAACCCCGCCCTC

22

192

Z5352

19

TTGCCCTGCTATCAAGGGTTG

21

CGTGCATCCAGCAACCAATC

20

149

Z5370

1

GCCATCCAGAGCCAGAGATACA

22

ATACTGACCAGCGGGAAACTCC

22

100

Z5393

15

CTCCACTCATACACGGACACCG

22

TGGCTGTAATCCGCCACTGA

20

208

Z5394

9

ATCGTGCAGCCCTACTTTGTG

21

GACAATTTCCTGCCAAACAACA

22

100

Z5395

13

CAGCCCCCTCAGTCACGACT

20

CGCGCCCTCTCTGAGAACAT

20

201

Z5413

24

TTGATGATCCCACAATGCGG

20

GGGATGTTTGCCAGCTGCTT

20

294

Z5424

22

TCCCCAGAGATGAGTTGCAGC

21

TCGAGCCAGAAGACCAAGTGG

21

233

Z5435

14

CCTTGTGCCCCTCAAATGCG

20

GTCATGGGAGGGAATGGTGC

20

122

Z5436

14

TGGCAGAGTGAACAATGCAGTG

22

GTTTTTTTTCACACCCCATTGC

22

123

Z5442

18

AACTGACTGTAGCGCATGGGG

21

CAGAGGTCGCCACAGTGGAA

20

149

Z5450

7

TGCAGAAGCCTGAAACAGAATG

22

AACACATCAGTAGGCGTGCACC

22

306

Z5467

7

AAAGCCCCTGATGAATAATGGG

22

ATCGCTGTTCTCTGGCGACC

20

294

Z5473

5

GTCAAGACCAGCAAACCCAGTG

22

TTTGCAAACACTTGATGGGGA

21

273

Z5478

24

GGTTTATTCGGCTGTGGTGACC

22

GATTGGTTCACAGACGCAGACG

22

296

Z5479

18

AGCCGTATGACAGCTTTCCAGG

22

CTGTCCACAATGAAGCAGCACC

22

211

Z5481

2

TTCTGAGCCGTAGAACCGCA

20

CACTCACACTTTCTTTTGCGCG

22

150

Z5500

1

TTTTGTGGATGTCCTCGGCC

20

ACTCGCCTGCATGAAGCAGA

20

241

Z5503

21

GTGAGTCGGATTCAGTAGGCCA

22

GCAAACTCCACACAGAAATGCC

22

245

Z5504

17

AAAGCCGAATTGCTCAAATCAT

22

GGTAATGGCCCAGCCCTGAT

20

382

Z5508

1

TAGCGTGCCATGCGTTTTTG

20

GATGTTCCTGCCTTATCGGCC

21

208

Z5526

23

AGCTGCCAATCAAAGTCTGCG

21

CCCTTCACCTGCCATTTTGC

20

215

Z5538

5

TCAGCCACATTAGGGGAAAGC

22

GCCATCCATGTTGGCTGTAGG

21

225

Z5552

5

AAATGCTGTGCACCGTGTATGC

22

ACCCTGGGTATTTTGAGCTGAA

22

229

Z5563

7

TGCAGGTTGTTCGGTCCTGA

20

TCACAATGCACACAACCCCC

20

250

Z5564

9

CAGTGCTAACCACAGCACCACC

22

CAGCCCCAACAATTTGTCCC

20

236

Z5583

19

CGGAGCCACTCAGATCAGCA

20

ACCTCTGAGAACGCAGGTTTGG

22

317

Z5608

13

TGCCTAATGGAGGACGGCAT

20

AGGTGAGCACAGGCTTGAATCT

22

165

Z5611

2

CGACACAACGGTGAGCTTGA

20

ATCATCCCTCATGAGCCCCA

20

172

Z5623

3

GGAGAATGAATGGTGACCTTGC

22

CTTCCCACCCACAGAGAGGG

20

182

Z5624

24

GACAGCAGCTCCAGATCCAGTG

22

GCGCTGTCAGGACTGTGAGC

20

276

Z5643

13

AGTGGAGTTGACCAGCTGCTTG

22

CCCCAGAATTAAAACTTCGCCA

22

112

Z5649

7

TCAGAGTTGCGGTCAAAACATC

22

AATGCATCATCACCAGGCTG

20

150

Z5657

24

GCCATCATGGAGTCCAACCC

20

TCCTCGTAAACCACCAAAACCA

22

182

Z5659

25

CAATCGAATCACAGCTCTTGGG

22

CGTTTCCTGAACACTCTGCAGC

22

181

Z5669

25

TGTTGATCATCAGTTGCAGTGC

22

GCCTCTGCAAACAAGTTTCCG

21

229

Z5675

19

GATGAGGGTGGGCTGGTTTG

20

TGACCCCTGTTTGACCAGTCTG

22

226

Z5679

19

TGGGTTTTCCATCCTCACGG

20

TGGCTGTGCTTCAGCAGGTG

20

250

Z5683

23

CGGATATTGGATTATCGGCTCA

22

AACGATCTGCATGTGCGAGC

20

115

Z6007

13

AGCCCTAAACAAACCGGC

18

GAGCATGATCTGCTCGTTAGG

21

134

Z6010

17

CTGCGACCGTGAGTGAAGT

19

CCAACAGCACTCTGAGGACA

20

102

Z6017

23

ATAAGTTGGCCGGTTCATTG

20

GACTGAAACCAGCGACCTTC

20

241

Z6019

3

GCAGTGTCAATACTTGCTCTCG

22

ATCCTCTGAGAAACCAGACAGC

22

131

Z6024

15

CTGCAGGCTTAATGCATTCA

20

GGCTCAGCAGTTACATGCAA

20

215

Z6058

8

TAACCGGACTCACCAGAACC

20

AGACGGGGCTGAGATTATTG

20

308

Z6104

13

TCAGACTTCTGTTTGCCCG

19

CATGTGCCTATTGCCAACTG

20

116

Z6272

11

GGATGGACAGTGCTAGTGAATG

22

CATTTGAGGACACTGACCAGA

21

255

Z6323

5

TTTGCACTTGAAAGGGCTTT

20

CCTTGGGTACACTTGGCATT

20

113

Z6365

16

CAGACAAACATTGGCACAGG

20

CGTGTGCTTACACTGTCTGACT

22

242

Z6390

10

GGCCTTCGATCCAAAGATCT

20

GTGCCTATCGAGGAGTCGAC

20

148

Z6523A B

6,7

AGGACGTCACCAATGTTCTC

20

CTTGATAAAGGTGACCCGTACC

22

261

Z6543

15

TACTAATTACCCGCCCCACA

20

CGTTTAGTTGAAGTGAAAGGCC

22

122

Z6596

4

GATGTCCACCTTTCCACCC

19

GGTCACAGGGTGGCAGTC

18

178

Z6601

6

TGGGGAGAGAAATCCCTCTT

20

AAGTTTCAGGACATCAAATGGG

22

154

Z6603

17

TCTGTTGAACATCATTTGGGA

21

GACGTCTGTTATGTGGATTGAC

22

186

Z6614

5

AGCGCTTAGATCAGTTTAACAG

22

GTGTGCTGGAAAGCTGTGAA

20

193

Z6617

2

ACCGATGGGAACAATAAAAGA

21

ATCGATGTATTGTGCAGTGTCC

22

146

Z6657

13

TGTGTCCCAGCAATCATTGT

20

GGATCACATGTGCGATGAAG

20

159

Z6666

14

TGCTGCTGATGATGTGACAA

20

TTTAATAGGTCACAGCACACGC

22

163

Z6682

11

TCCAGAAGTCAGATGGAGAAGA

22

CCTGCTCCTCTCACTAACCG

20

166

Z6745

13

GAGGTGCATTATAGCCTGTTCC

22

AGATGTGAAAGTCCATGCTGG

21

222

Z6763

8

TGATGACCTCCTGACAGTCG

20

ACCCAGAGGTAAGACGCAGG

20

133

Z6802

1

AGACTGAAGTGCACTGTTGTCC

22

CTCCGACGCGATCATATTAA

20

251

Z9011

3

AGTGCAGGACTGCAGCACTG

20

CAGCACCCATAGACCAAACA

20

159

Z9041

15

TGTTCAGCTCTCACTGGCC

19

AGTGTCCGTCAAACATGAAGG

21

170

Z9054

14

AGTGGGAAAACATGTGAGACG

21

TCTTTCCTGCGTGGATGAG

19

155

Z9055

21

ACCACTGGCGCTCATCTC

18

CGCCTTCATCATCATCACC

19

132

Z9060

14

CATTCAGAGCGAGGTGAACA

20

GCAGCATGATCGTGATACTG

20

170

Z9061

12

GTCCCCAAAATGCTTCTTGA

20

TCATGCATGTTTAGGACGGA

20

322

Z9067

7

TGCACACTGGTGCTGGAT

18

TTGTGTCCAGTGTCTGCACA

20

149

Z9068

7

TGCGCTTCATCCTCTACTAAA

22

GTGAGCTGCTGCCCTGTG

18

250

Z9127

24

TGCTCCGATCACTTGCACT

19

GCGTTTCCTGTGATGGTTG

19

267

Z9154

18

CACGGGCTCTCTAATTGGAA

20

CCATTAGCAAGTCGTGACGA

20

157

Z9199

10

GAGCCGCTTACATCTGAAGC

20

CTGCACGTCCACTCAGCTT

19

230

Z9208

10

GTGCCGTGCTCTCACTCAT

19

CTGCAGACTGTCACCTGTGC

20

205

Z9231

18

GAAATTACAGCTCCATAACGGC

22

TCTGCTTCATTCCCTGCTG

19

228

Z9247

4

TTGACAGCTTTCAGGTGCAG

20

TGCCCATGTTCATAGCTCTG

20

118

Z9252

19

TGACAACACTCTGTCAGCACC

21

GCATACAAACAGGGGCAAGT

20

205

Z9279

8

TGCATAAAGTCAGGAGGTTCA

21

TCTGCGCTTAACAATGCACT

20

150

Z9290

25

GGCGGACAGCACAAGAGT

18

CTCTTGTGGTCCAGAACTGTTG

22

186

Z9323

7

TGTGTGAGACACAGGTGAAGC

21

AACTGCTCAGATGTGACAGGA

21

184

Z9351

23

TCTGGTGAAATACTGCGCTG

20

CACACACCCTCCCTCAGTTT

20

240

Z9394

1

GGCCTCACACAATTTCAAAT

20

GAGACGAGCAGAAGTCCCTG

20

273

Z9463

3

GTTGGTGGAGGGGAGAGAAT

20

CAAAGATAAAGCAGGGGCAG

20

150

Z9516

22

GCGTATTTAGCGTCCTGCTC

20

CGCTCACAGGAGATCATGAA

20

180

Z9701

10

CACTGATGCTCTCACCTCCA

20

ATGCTTGTGTGGGTGTCTCA

20

125

Z9708

20

GAGCGGCAAGTATGTGGATT

20

AGGAGGCGAATCAGACTGAA

20

208

Z9738

6

CAGATCCGGAGCTTCAACTC

20

CAGCCAGCAGTGTAAGCTGA

20

188

Z9794

20

TCACCTTCTGAGGAGCAGGT

20

GTGGCTGCTGGAGCTTATTC

20

201

Z9852

24

ACAGCTCTTCTCCAGCAGGA

20

GTGCCTTCCAATAAAGCCAA

20

267

Z9868

13

CGTGTGTGAGAGTTTTGGGA

20

TCAAAGCCTGTTCACAGTGC

20

186

Z9871

5

TGTGAATCCATGGGAATGAA

20

CCACATCTGCCATGAAAATG

20

198

Z9881

16

AGCTGATGTAATCATTCCCACA

22

CCGCTGTCCCTTCTAGAATG

20

142

Z9920

4

GCTGCTGAGTTGTGGTCTTG

20

TGCCCTTAAATCATACAAAATTACA

25

204

Z9964

3

TGGCTGTCTATGAGGTATGGC

21

GACGACAGAACACAGCAACG

20

263

Z10056

20

TTGCAATGTGTATGCTGTCAAA

22

CAAGTGTCCACTCACCCAAA

20

198

Z11608

18

ATCAGAAGAGTATTGTCAACGCA

23

CACAAACTGAACTGCAGACTCC

22

220

Z11623

8

GCTAAGAAAGACGCATTACGC

21

TTATGCGTGTTGAATTTGAAGG

22

138

Z13202

16

TAAACAATGCATTGGGCTGA

20

TCTGGGTAGACTAGTGCGACC

21

191

Z13213

9

TCGGCAGGGCTTTTCACT

18

GTTAGTCTCCTCGACGGCTG

20

179

Z13214

20

ATGCCCTTACAGTTGCAACC

20

CATGTTTTCCCCATGCTTG

19

240

Z13215

19

GTGTTGATCCCCTGGGCA

18

ACAAGTCCCCACAAGGTCAA

20

124

Z13218

12

TTGATGACGCTCTGATCCTG

20

TCTGCTGACCTTGTGGTCTG

20

241

Z13219

10

CAAAAACAGCAGTATCCGCA

20

GGTCCCCATACAGCTGACAC

20

210

Z13220

18

CGGCTTTAAAGATTCACTGACA

22

TTGAGCAATAATGTGAAGCTGC

22

130

Z13221

9

CTGTTCAGCCACTGAAACACA

21

CTGCTCACCTGATCACCATG

20

150

Z13223

22

TCTGACTTTGCTGAGCTGGA

20

CCAAGAACCATTAGAAACTGCA

22

208

Z13231

18

CCTGGAGCCAGGTACAGCTA

20

CTCTGCTGAGCGAGAGGTTT

20

261

Z13232

25

GCTGCGTGATATTCATGGG

19

CTGTATCCTGCTATACAGCCCC

22

111

Z13236

23

GACTTTTGCCAGAATTCAATCC

22

AAGCTACCTGTGCGCCAC

18

125

Z13244

11

CCTGTAACATGTCTCCAAAACA

22

GCGTCACCAAAGAGTCCTATG

21

203

Z13250

13

GCTGACAGCGGACTTAAAGG

20

CCAAGATCTCTGGAATCCCA

20

215

Z13252

12

GTTGGGTGTAGGGGTAGGGT

20

TCCTCAAACACCAACAGAAGG

21

224

Z13253

7

TGTTGATGTTGACCTGGGAA

20

TGCATTTCCTGGATGAGTGA

20

150

Z13271

14

AACAATACTGAACGGTGAGCG

21

TCTTCCCGGAGTCATCCTC

19

147

Z13274

4

TGGTTAGACCACTGTAGACCCC

22

AGCGACAACACACTCCTGC

19

236

Z13275

6

CATGCTGTCCCAACACAAAC

20

CACCTGTGGATGTTCAGGTG

20

144

Z13276

12

GGGTGTTTTCCAGTGATGCA

20

GCACTGTTTGCTTGCAAAGA

20

159

Z13279

5

CTCCCTAAGCATGATGCACA

20

CTGGTCTTCCACGTTGGG

18

256

Z13281

2

TCAATATTGCACTGACCCACA

21

CATGCTCAAACACGCTCACT

20

143

Z13288

8

AGTCTCACGGTGAGTCTGACA

21

GGCAGCTTTCCCATCATG

18

164

Z13289

9

TATGGATGCCATTGTAGCGA

20

CATGGTATCCCACTGTTCCC

20

140

Z13292

19

CAAGGCTGGCGTTATCAGAT

20

GACCACCCACATAAACCCAC

20

218

Z13296

1

TCTGAGTGCACCAAATGAGTG

21

AGTTGGGTCAAACCCATGTC

20

102

Z13395

11

ACCAACCCTGAGGGAGTTTT

20

CCTTGCTACCGCTATGAATG

20

111

Z13411

11

CCATCCGTCTTTCTGCTCTC

20

CCAGCTCTGTGTGTTTGGAA

20

289

Z13412

8

TGGTAAGGGAAGGAATGACG

20

GCCTGTCATACCGCTCTGAT

20

254

Z13450

9

CAGCCGTGTGTGGTCATTAG

20

AAATGCATCTGGAGACCAGG

20

202

Z13632

20

AGGATGATGAAGACGGATCG

20

TCGCCTGAGGTGAGTTTTTC

20

264

Z15410

2

ACGCTCCTAAAACAGGCAGA

20

CAGACTGAGCTCCATTTCTGC

21

134

Z15414

5

ACAGGAACATCTCCTTCCACA

21

ATTTGTCCGACGGGTCACTA

20

202

Z15417

18

CTGCAGTCTAGCCAGCAGC

19

GACGGCAGCTCATTCTTCTC

20

108

Z15421

21

AGGATGACATCACTCTGGGG

20

TCCCCTGGTGGCAGTAATTA

20

257

Z15422

23

TGAAAGTGGACATATCCAGCC

21

CGCTGTCCTTCTTTCCACTC

20

128

Z15424

1

GACCTTGTCCCTTTCTCGTC

20

TTGTTGGGAACAGGGAAGAG

20

279

Z15438

13

CACCGTGTTTTGTCATTTGC

20

GAGAGCAGAAGACTCATTTGCA

22

185

Z15448

6

ATGTTAGAAAACAGGCGCGT

20

GCCATGCATAACTTTAGCACA

21

146

Z15449

9

GATAGCCAAGCGAGCTGC

18

TTGAAGGCAAGGGAGGAAG

19

151

Z15451

19

TTGCAGCTACATTTGCGTCT

20

TCAAGAATTGTGTTGTTCCAGC

22

236

Z15453

16

CACGATCACCAGCGATCTAA

20

GCGTCTAGCAATATCGCTCC

20

193

Z15455

13

TTCAGGAGGCACACGTCTC

19

TATAAACCTTGTGCCAGTGGG

21

250

Z15457

3

TCGCCCCATTATTTTATACACC

22

CTTTCTTCATTTCCTGTCACCC

22

118

Z15479

3

GCCAAACATTCCAGCTGATT

20

AGCCGGACTCAAATGCAG

18

163

Z15480

25

AACCCATCTATTCTGTTGGTCG

22

ATGATGAAGGTGTCGCTCG

19

150

Z15491

21

AGATCGGCCCACTCACATAC

20

AAGGGCTGGTTGATTCACAC

20

135

Z15493

6

TGCTCTGGTGTGATGTTTTACC

22

CCAACACACTTTCGTCCAGA

20

184

Z17203

24

ACAGAAGACTCCTGTTTTTGGC

22

TTGGGTAGCTAAATTGTGTGTG

22

258

Z17212

6

TTTGAAAAGTCTGTCCATCACG

22

GGACAAGCAACAGGTCAGGT

20

128

Z17223

13

ACAAACGGTTTTGTTCGGTC

20

ACTCATGATTCAACTGTGCCC

21

137

Z17233

13

AATCGACAGCATTAATCACACG

22

AAAACAAAGTCAAATTGGCAGA

22

167

Z20006

17

GAAAGCATCAAACACTGCCA

20

GGTTAAATGTCAGGGGCAAA

20

204

Z20046

20

TTCAGGTTTAAGGTTATAAAAACGA

25

AACCAATATGTCATGGCATCC

21

247

Z20058

3

GGTGTTTCGTCCACTGTTGA

20

TAACTTTTCAAACGGGACGG

20

108

Z21982

15

TGGAAAAACATGAATGCTGC

20

AACACCTGCTGGGTAAGTGC

20

182

Z22083

17

GCACATTGTAGCTCGCTCTG

20

CTCAGACCACCACCTGTCCT

20

199